Quick Order

Cynomolgus monkey PLXDC1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus PLXDC1 cDNA Clone Product Information
Gene_bank_ref_id:XM_005583997.1
RefSeq ORF Size:1503bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) plexin domain containing 1 with C terminal Myc tag.
Gene Synonym:PLXDC1
Species:Cynomolgus
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Plexin domain-containing protein 1, also known as tumor endothelial marker 3, tumor endothelial marker 7 and PLXDC1 and TEM3, is a secreted, cytoplasm and single-pass type I membrane protein which belongs to the plexin family. PLXDC1 / TEM3 is detected in endothelial cells from colorectal cancer, and in endothelial cells from primary cancers of the lung, liver, pancreas, breast and brain. It is expressed in fibrovascular membrane with increased expression in individuals with proliferative diabetic retinopathy. PLXDC1 / TEM3 is not detectable in endothelial cells from normal tissue. PLXDC1 / TEM3 plays a critical role in endothelial cell capillary morphogenesis. PLXDC1 / TEM3 may play a significant role in the proliferation and maintenance of neovascular endothelial cells in the formation of fibrovascular membranes (FVMs). PLXDC1 / TEM3 may be a molecular target for new diagnostic and therapeutic strategies for proliferative diabetic retinopathy (PDR). PLXDC1 / TEM3 interacts with NID1. It may also interact with CTTN.

References
  • Beaty,R.M. et al., 2007,J Neurooncol. 81 (3):241-8.
  • Miller,S.F. et al., 2007, Gene Expr Patterns. 7 (5):635-44.
  • Yamaji,Y. et al., 2008, Invest Ophthalmol Vis Sci. 49 (7):3151-7.
  • Size / Price
    Catalog: CG90635-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"