Quick Order

Text Size:AAA

Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CFL1cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:501
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) cofilin 1 (non-muscle) DNA.
Gene Synonym:cofilin-1
Species:Cynomolgus
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90578-ACG$325
Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90578-ACR$325
Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90578-ANG$325
Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90578-ANR$325
Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90578-CF$295
Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90578-CH$295
Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90578-CM$295
Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90578-CY$295
Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone)CG90578-G$95
Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90578-NF$295
Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90578-NH$295
Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90578-NM$295
Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90578-NY$295
Cynomolgus monkey CFL1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90578-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

CFL1, also known as n-cofilin, is a member of the ADF/Cofilin family. This family comprises three genes: CFL1, CFL2 and DSTN (destrin). ADF/Cofilin family members bind G-actin monomers and depolymerize actin filaments through two mechanisms: severing and increasing the off-rate for actin monomers from the pointed end. Cofilin also binds with other proteins such as myosin, tropomyosin, α-actinin, gelsolin and scruin. These proteins compete with cofilin for actin binding. Сofilin also plays a role in innate immune response. CFL1 contains 1 ADF-H domain and is widely distributed in various tissues. It is important for normal progress through mitosis and normal cytokinesis.

References
  • Lappalainen P. et al., 1997, Nature. 388 (6637): 78-82.
  • Ichetovkin I. et al., 2000, Cell Motil. 45 (4): 293-306.
  • Carlier MF. et al., 1997, J Cell Biol. 136 (6): 1307-22.
  • Size / Price
    Catalog:CG90578-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"