Quick Order

Text Size:AAA

Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CTRCcDNA Clone Product Information
cDNA Size:807
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) chymotrypsin C (caldecrin) DNA.
Gene Synonym:CTRC
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90522-ACG$325
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90522-ACR$325
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90522-ANG$325
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90522-ANR$325
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90522-CF$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90522-CH$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90522-CM$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90522-CY$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90522-NF$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90522-NH$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90522-NM$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90522-NY$295
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone)CG90522-U$95
Cynomolgus monkey CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90522-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Chymotrypsin C (abbreviated for CTRC), also known as caldecrin or elastase4, is a digestive enzyme of the peptidase S1 family. This enzyme is synthesized as an inactivate chymotrypsinogen. On cleavage by trypsin into two parts that activate each other by removing two small peptides in a trans-proteolysis, chymotrypsin C produced. N-linked glycosylation of human CTRC is required for efficient folding and secretion, however, the N-linked glycan is unimportant for enzyme activity or inhibitor binding. It has been proposed that CTRC is a key regulator of digestive zymogen activation and a physiological co-activator of digestive carboxypeptidases proCPA1 and proCPA2. Mutations that abolish activity or secretion of CTRC increase the risk for chronic pancreatitis. It's speculated that CTRC might regulate pancreatic cancer cell migration in relation to cytokeratin 18 expression. The pancreatic cancer cell migration ability was downregulated in pancreatic cancer Aspc-1 cells that overexpressed CTRC, whereas the cell migration ability was upregulated in Aspc-1 cells in which CTRC was suppressed. 

  • Lacruz RS, et al. (2011) Chymotrypsin C (caldecrin) is associated with enamel development. J Dent Res. 90 (10): 1228-33.
  • Zhou J, et al. (2011) Chymotrypsin C mutations in chronic pancreatitis. J Gastroenterol Hepatol. 26 (8): 1238-46.
  • Wang H, et al. (2011) Effect of chymotrypsin C and related proteins on pancreatic cancer cell migration. Acta Biochim Biophys Sin (Shanghai). 43 (5): 362-71.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks