After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey LAMP3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LAMP3cDNA Clone Product Information
cDNA Size:1251
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) lysosomal-associated membrane protein 3 DNA.
Gene Synonym:LAMP3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Dendritic cell-lysosomal associated membrane protein (DC-LAMP)/CD208, also known as LAMP3, is a member of the lysosomal associated membrane protein (LAMP) family, which is specifically expressed by human dendritic cells (DCs) upon activation and therefore serves as marker of human DC maturation. Confocal and immunoelectron microscopy showed that mouse DC-LAMP protein co-localizes with lbm180, a specific marker for the limiting membrane of lamellar bodies that contain surfactant protein B. The present study demonstrates that DC-LAMP is constitutively expressed by mouse, sheep, and human type II pneumocytes. DC-LAMP is constitutively expressed in normal type II pneumocytes. DC-LAMP is detected first in activated human DC within MHC class II molecules-containing compartments just before the translocation of MHC class II-peptide complexes to the cell surface, suggesting a possible involvement in this process. Furthermore, overexpression of LAMP3 is actively involved in tumor invasion through increased migration into lymph-vascular spaces.

  • Salaun B, et al. (2003) Cloning and characterization of the mouse homologue of the human dendritic cell maturation marker CD208/DC-LAMP. Eur J Immunol. 33(9): 2619-29.
  • Salaun B, et al. (2004) CD208/dendritic cell-lysosomal associated membrane protein is a marker of normal and transformed type II pneumocytes. Am J Pathol. 164(3): 861-71.
  • Ishigami S, et al. (2010) Prognostic value of CD208-positive cell infiltration in gastric cancer. Cancer Immunol Immunother. 59(3): 389-95.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks