Quick Order

Cynomolgus monkey KLRC1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus KLRC1 cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:702bp
cDNA Description:Full length Clone DNA of Macaca mulatta killer cell lectin-like receptor subfamily C, member 1 with C terminal Myc tag.
Gene Synonym:NKG2A, CD159a, NKG2-A, KLRC1
Species:Cynomolgus
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

NKG2, also known as NKG2A(CD159A), is a member of the killer cell lectin-like receptor family. This family is a group of transmembrane proteins preferentially expressed in NK cells. Members of this fmaily are characterized by the type II membrane orientation and the presence of a C-type lectin domain. NKG2 contains 1 C-type lectin domain and forms a complex with another family member, KLRD1/CD94. It is expressed only in NK-cells, but not in T-cells or B-cells. It has been shown that NKG2 represents a family of related cDNA clones, designated NKG2A, NKG2B, NKG2C, and NKG2D, which encode type 2 integral membrane proteins (extracellular C-terminus) containing a C-type lectin domain. Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NKG2 functions as a receptor for the recognition of MHC class I HLA-E molecules by NK cells and some cytotoxic T-cells.

References
  • Angelini DF, et al. (2011) NKG2A inhibits NKG2C effector functions of gamma delta T cells: implications in health and disease. J Leukoc Biol. 89(1):75-84.
  • Ge SJ, et al. (2011) Expression of NKG2D and NKG2A with their ligands MHC-I A/B and HLA-E in acute leukemia patients and its significance. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 19(2):312-6.
  • Ablamunits V, et al. (2011) NKG2A is a marker for acquisition of regulatory function by human CD8+ T cells activated with anti-CD3 antibody. Eur J Immunol. 41(7):1832-42.
  • Size / Price
    Catalog: CG90214-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"