After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Cynomolgus monkey DPP4 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus DPP4 cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:2301bp
cDNA Description:Full length Clone DNA of Macaca mulatta dipeptidyl-peptidase 4 with C terminal Myc tag.
Gene Synonym:DPP4
Species:Cynomolgus
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Dipeptidyl peptidase-4 (DPP4) or adenosine deaminase complexing protein 2 (ADCP 2) or T-cell activation antigen CD26 is a serine exopeptidase belonging to the S9B protein family that cleaves X-proline dipeptides from the N-terminus of polypeptides, such as chemokines, neuropeptides, and peptide hormones. The enzyme is a type II transmembrane glycoprotein, expressed on the surface of many cell types. It is also present in serum and other body fluids in a truncated form (sCD26/DPPIV). The soluble CD26 (sCD26) as a tumour marker for the detection of colorectal cancer (CRC) and advanced adenomas. As both a regulatory enzyme and a signalling factor, DPP4 has been evaluated and described in many studies. DPP4 inhibition results in increased blood concentration of the incretin hormones glucagon-like peptide-1 (GLP-1) and gastric inhibitory polypeptide (GIP). This causes an increase in glucose-dependent stimulation, resulting in a lowering of blood glucose levels. Recent studies have shown that DPP4 inhibitors can induce a significant reduction in glycosylated haemoglobin (HbA(1c)) levels, either as monotherapy or as a combination with other antidiabetic agents. Research has also demonstrated that DPP4 inhibitors portray a very low risk of hypoglycaemia development, and are a new pharmacological class of drugs for treating Type 2 diabetes.

References
  • Doupis J, et al. (2008) DPP4 inhibitors: a new approach in diabetes treatment. Adv Ther. 25(7): 627-43.
  • Havre PA, et al. (2008) The role of CD26/dipeptidyl peptidase IV in cancer. Front Biosci. 13: 1634-45.
  • De Chiara L, et al. (2009) Soluble CD26 levels and its association to epidemiologic parameters in a sample population. Dis Markers. 7(6): 311-6.
  • Matteucci E, et al. (2009) Dipeptidyl peptidase-4 (CD26): knowing the function before inhibiting the enzyme. Curr Med Chem. 16(23): 2943-51.
  • Size / Price
    Catalog: CG90180-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"