Quick Order

Human DCXR Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DCXRcDNA Clone Product Information
cDNA Size:735
cDNA Description:ORF Clone of Homo sapiens dicarbonyl/L-xylulose reductase DNA.
Gene Synonym:XR, DCR, HCR2, P34H, HCRII, KIDCR, SDR20C1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

DCXR, also known as HCR2, belongs to the short-chain dehydrogenases/reductases (SDR) family. It is highly expressed in kidney, liver and epididymis. In the epididymis, DCXR is mainly expressed in the proximal and distal sections of the corpus region. HCR2 is weakly or not expressed in brain, lung, heart, spleen and testis. DCXR catalyzes the NADPH-dependent reduction of several pentoses, tetroses, trioses, alpha-dicarbonyl compounds and L-xylulose. DCXR participates in the uronate cycle of glucose metabolism. It may play a role in the water absorption and cellular osmoregulation in the proximal renal tubules by producing xylitol, an osmolyte, thereby preventing osmolytic stress from occurring in the renal tubules.

  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Pierce SB, et al. (2011) Garrod's fourth inborn error of metabolism solved by the identification of mutations causing pentosuria. Proc Natl Acad Sci. 108(45):18313-7.
  • Udeshi ND, et al. (2012) Methods for quantification of in vivo changes in protein ubiquitination following proteasome and deubiquitinase inhibition. Mol Cell Proteomics. 11(5):148-59.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items