Quick Order

Cynomolgus monkey REG1A Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
REG1AcDNA Clone Product Information
cDNA Size:501
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) regenerating islet-derived 1 alpha DNA.
Gene Synonym:REG1A
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Regenerating (reg) gene encodes protein that has been involved in pancreatic lithogenesis and the regeneration of islet cells and therefore the abnormality of reg genes could be associated with fibrocalculous pancreatopathy. REG I has been shown to be crucial for induction of ductal epithelial cells to differentiate into some cells. Lithostathine-1-alpha, also known as Pancreatic stone protein, Pancreatic thread protein, Regenerating islet-derived protein 1-alpha, REG1A, REG-1-alpha, and PSPS, is highly expressed in fetal and infant brains. REG1A contains one C-type lectin domain and is a known growth factor affecting pancreatic islet beta cells. REG1A may act as an inhibitor of spontaneous calcium carbonate precipitation. It may also be associated with neuronal sprouting in brain, and with brain and pancreas regeneration. REG1A has been reported to be expressed in human cancers, and it may be positively correlated with patient's prognosis. REG3A and REG1A proteins are both involved in liver and pancreatic regeneration and proliferation. High levels of REG1A expression by tumor cells are an independent predictor of a poor prognosis in patients with non-small cell lung cancer (NSCLC).

  • Boonyasrisawat W, et al. (2002) Analysis of the reg1alpha and reg1beta gene transcripts in patients with fibrocalculous pancreatopathy. Southeast Asian J Trop Med Public Health. 33(2): 365-72.
  • Tezel E, et al. (2004) REG I as a marker for human pancreatic acinoductular cells. Hepatogastroenterology. 51(55): 91-6.
  • Geng J, et al. (2009) REG1A predicts recurrence in stage Ta/T1 bladder cancer. Eur J Surg Oncol. 35(8): 852-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items