Quick Order

Cynomolgus monkey IL10RB Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL10RBcDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:819
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) interleukin-10 receptor subunit beta-like DNA.
Gene Synonym:IL10RB
Species:Cynomolgus
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

IL-10 Family & Receptor Related Products
Background

Interleukin 10 receptor, beta subunit (IL10RB/IL-10RB) also known as Cytokine receptor family 2 member 4, Interleukin-10 receptor subunit 2, and cytokine receptor family II, member 4, is a subunit for the interleukin-10 receptor. IL10RB/IL-10RB belongs to the cytokine receptor family. It is an accessory chain essential for the active interleukin 10 receptor complex. Coexpression of this and IL10RA proteins has been shown to be required for IL10-induced signal transduction. Defects in IL10RB/IL-10RB are the cause of inflammatory bowel disease type 25 (IBD25). It is a chronic, relapsing inflammation of the gastrointestinal tract with a complex etiology. It is subdivided into Crohn disease and ulcerative colitis phenotypes. Crohn disease may affect any part of the gastrointestinal tract from the mouth to the anus, but most frequently it involves the terminal ileum and colon. Bowel inflammation is transmural and discontinuous; it may contain granulomas or be associated with intestinal or perianal fistulas. In contrast, in ulcerative colitis, the inflammation is continuous and limited to rectal and colonic mucosal layers; fistulas and granulomas are not observed. Both diseases include extraintestinal inflammation of the skin, eyes, or joints.

References
  • Josephson K, et al. (2001) Crystal structure of the IL-10/IL-10R1 complex reveals a shared receptor binding site. Immunity. 15 (1): 35-46.
  • Yoo KH, et al. (2011) Association of IL10, IL10RA, and IL10RB polymorphisms with benign prostate hyperplasia in Korean population. J Korean Med Sci. 26(5): 659-64.
  • Size / Price
    Catalog:CG90116-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"