Quick Order

Human HSPA1A ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HSPA1A cDNA Clone Product Information
Gene_bank_ref_id:NM_005345.5
RefSeq ORF Size:1926bp
cDNA Description:Full length Clone DNA of Homo sapiens heat shock 70kDa protein 1A with N terminal Flag tag.
Gene Synonym:HSP72, HSPA1, HSP70I, HSPA1B, HSP70-1, FLJ54303, FLJ54370, FLJ54392, FLJ54408, FLJ75127, HSP70-1A, HSPA1A
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-HSPA1A
Restriction Site:KpnI + XbaI (6kb + 1.97kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 51 C/A, 261 T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human HSPA1A Gene Plasmid Map
Human HSPA1A natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

HSPA1A is a member of the Hsp70 protein family. The 70 kilodalton heat shock proteins (Hsp70s) are a family of ubiquitously expressed heat shock proteins. HSP are abundant and conserved proteins present in all cells. Upon temperature shock or other stress stimuli, HSP are synthesized intracellularly, which may protect cells from protein denaturation or from death. Extracellularly, HSP can serve a cytokine function to initiate both innate and adaptive immunity through activation of APC. HSP serves also a chaperone function and facilitates presentation of antigen peptide to T cells. Molecular chaperones of the Hsp70 family have diverse functions in cells. They assist the folding of newly synthesized and stress-denatured proteins, as well as the import of proteins into organelles, and the dissociation of aggregated proteins. The well-conserved Hsp70 chaperones are ATP dependent: binding and hydrolysis of ATP regulates their interactions with unfolded polypeptide substrates, and ATPase cycling is necessary for their function. All cellular functions of Hsp70 chaperones use the same mechanism of ATP-driven polypeptide binding and release. 

References
  • Heck TG, et al. (2011) HSP70 expression: does it a novel fatigue signalling factor from immune system to the brain Cell Biochem Funct. 29 (3): 215-26.
  • Chen T, et al. (2010) Stress for maintaining memory: HSP70 as a mobile messenger for innate and adaptive immunity. Eur J Immunol. 40 (6): 1541-4.
  • Young JC. (2010) Mechanisms of the Hsp70 chaperone system. Biochem Cell Biol. 88 (2): 291-300.
  • Size / Price
    Catalog: HG11660-NF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"