Quick Order

Text Size:AAA

Human PTS Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTScDNA Clone Product Information
Gene_bank_ref_id:BC009686
cDNA Size:438
cDNA Description:ORF Clone of Homo sapiens 6-pyruvoyltetrahydropterin synthase DNA.
Gene Synonym:FLJ97081, PTPS, PTS
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

PTS(6-pyruvoyltetrahydropterin synthase) belongs to the PTPS family. It catalyzes the elimination of inorganic triphosphate from dihydroneopterin triphosphate, which is the second and irreversible step in the biosynthesis of tetrahydrobiopterin from GTP. Tetrahydrobiopterin, also known as BH(4), is an essential cofactor and regulator of various enzyme activities, including enzymes involved in serotonin biosynthesis and NO synthase activity. Mutations in this gene result in hyperphenylalaninemia. PTS is involved in the biosynthesis of tetrahydrobiopterin, an essential cofactor of aromatic amino acid hydroxylases. PTS also catalyzes the transformation of 7,8-dihydroneopterin triphosphate into 6-pyruvoyl tetrahydropterin. Defects in PTS are the cause of BH4-deficient hyperphenylalaninemia type A (HPABH4A), also called 6-pyruvoyl-tetrahydropterin synthase deficiency (PTS deficiency) or hyperphenylalaninemia tetrahydrobiopterin-deficient due to PTS deficiency. HPABH4A is an autosomal recessive disorder characterized by depletion of the neurotransmitters dopamine and serotonin, and clinically by severe neurological symptoms unresponsive to the classic phenylalanine-low diet.

References
  • Ashida A, et al. (1994) A missense mutation (A to G) of 6-pyruvoyltetrahydropterin synthase in tetrahydrobiopterin-deficient form of hyperphenylalaninemia. Genomics. 24:408-10.
  • Ashida A, et al. (1993) cDNA cloning, expression in Escherichia coli and purification of human 6-pyruvoyl-tetrahydropterin synthase. Biochem. Biophys Res Commun. 195:1386-93.
  • Thoeny B, et al. (1992) Human 6-pyruvoyltetrahydropterin synthase: cDNA cloning and heterologous expression of the recombinant enzyme. Biochem Biophys Res Commun. 189:1437-43.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"