Quick Order

Human ECD ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ECD cDNA Clone Product Information
Gene_bank_ref_id:BC000721
RefSeq ORF Size:1935bp
cDNA Description:Full length Clone DNA of Homo sapiens ecdysoneless homolog (DrosophilA) with C terminal Flag tag.
Gene Synonym:GCR2, HSGT1, ECD
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

ECD, also known as ecdysoneless homolog, belongs to the SGT1 family. It is highly expressed in muscle and heart. ECD is a novel promoter of mammalian cell cycle progression. This function is related to its ability to remove the repressive effects of Rb-family tumor suppressors on E2F transcription factors. It is a novel tumor-promoting factor that is differentially expressed in pancreatic cancer and potentially regulates glucose metabolism within cancer cells. ECD may also be a transcriptional activator required for the expression of glycolytic genes.

References
  • Badzek S. et al., 2011, Wien Klin Wochenschr. 123 (23-24): 726-31.
  • Zhao X. et al., 2012, Breast Cancer Res Treat. 134 (1): 171-80.
  • Dey P. et al., 2012, Clin Cancer Res. 18 (22): 6188-98.
  • Size / Price
    Catalog: HG14311-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"