After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PCBP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PCBP1cDNA Clone Product Information
cDNA Size:1071
cDNA Description:ORF Clone of Homo sapiens poly(rC) binding protein 1 DNA.
Gene Synonym:HNRPX, HNRPE1, hnRNP-X, hnRNP-E1, PCBP1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Poly(rC)-binding protein 1, also known as Heterogeneous nuclear ribonucleoprotein E1, Alpha-CP1, Nucleic acid-binding protein SUB2.3 and PCBP1, is a family member of heterogeneous nuclear ribonucleoproteins (hnRNPs) that belong to RNA-binding proteins and bear three KH domains. PCBP1 is loosely bound in the nucleus. It may shuttle between the nucleus and the cytoplasm. It is abundantly expressed in skeletal muscle, thymus and peripheral blood leukocytes while a lower expression is observed in prostate, spleen, testis, ovary, small intestine, heart, liver, adrenal and thyroid glands. PCBP1 is widely expressed in many human tissues and involved in regulation of transcription, transportation process, and function of RNA molecules. PCBP1 plays a pivotal role in post-transcriptional regulation for RNA metabolism and RNA function in gene expression. PCBP1 acts as a negative regulator of CD44 variants splicing in HepG2 cells, and loss of PCBP1 in human hepatic tumor contributes to the formation of a metastatic phenotype.

  • Evans,J.R. et al., 2003, Oncogene  22 (39): 8012-20.
  • Huo,L.R. et al., 2008, Biochim Biophys Acta  1784 (11):1524-33.
  • Huo,L.R. et al., 2009, Beijing Da Xue Xue Bao  41 (4):402-8.
  • Zhang,T. et al., 2010, Mol Cancer 9 :72.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items