After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human LTC4S Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LTC4ScDNA Clone Product Information
cDNA Size:453
cDNA Description:ORF Clone of Homo sapiens leukotriene C4 synthase DNA.
Gene Synonym:MGC33147, LTC4S
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human LTC4S Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Related Products
Product nameProduct name

Leukotriene C4 synthase, also known as LTC4 synthase, Leukotriene-C(4) synthase, and LTC4S, is a multi-pass membrane protein which belongs to the MAPEG family. LTC4S is detected in lung, platelets and the myelogenous leukemia cell line KG-1 (at protein level). LTC4S activity is present in eosinophils, basophils, mast cells, certain phagocytic mononuclear cells, endothelial cells, vascular smooth muscle cells and platelets. LTC4S is essential for the production of cysteinyl leukotrienes (Cys-LT), critical mediators in asthma. Mutagenic analysis of the conjugation function of human LTC4S has identified R51 and Y93 as critical for acid and base catalysis of LTA4 and reduced glutathione, respectively. A comparison across species for proteins that possess LTC4S activity reveals conservation of both of these residues, whereas R51 is absent in the FLAP molecules. Thus, within the glutathione S-transferase superfamily of genes, alignment of specific residues allows the separation of LTC4S family members from their most structurally similar counterparts, the FLAP molecules. Defects in LTC4S are the cause of leukotriene C4 synthase deficiency (LTC4 synthase deficiency). LTC4 synthase deficiency is a fatal neurometabolic developmental disorder. It is associated with muscular hypotonia, psychomotor retardation, failure to thrive, and microcephaly.

  • Gupta, N. et al., 1999, FEBS Lett. 449 (1): 66-70.
  • Penrose, JF. et al., 1999, Allergy Asthma Proc. 20 (6): 353-60.
  • Sayers, I. et al., 2003, Thorax. 58 (5): 417-24.
  • Schröder, O. et al., 2005, Cell Mol Life Sci. 62 (1): 87-94.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks