After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NME1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NME1cDNA Clone Product Information
cDNA Size:459
cDNA Description:ORF Clone of Homo sapiens non-metastatic cells 1, protein (NM23A) expressed in DNA.
Gene Synonym:NB, AWD, NBS, GAAD, NM23, NDPKA, NDPK-A, NM23-H1, NME1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

NME1, also known as Nucleoside Diphosphate Kinase A (NDK-A), or NM23-H1, belongs to the NDK family. NM23-H1 is known to have a metastasis suppressive activity in many tumor cells. Recent studies have shown that the interacting proteins with NM23-H1 which mediate the cell proliferation, may act as modulators of the metastasis suppressor activity. The interacting proteins with NM23-H1 can be classified into 3 groups. The first group of proteins can be classified as upstream kinases of NM23-H1 such as CKI and Aurora-A/STK15. The second group of proteins acts as downstream effectors for the regulation of specific gene transcriptions, GTP-binding protein functions, and signal transduction in Erk signal cascade. The third group of proteins can be classified as bi-directionally influencing binding partners of NM23-H1. As a result, the interactions with NM23-H1 and binding partners have implications in the biochemical characterization involved in metastasis and tumorigenesis. NDKA is increased in human postmortem cerebrospinal fluid (CSF), a model of global brain insult, suggesting that measurement in CSF and, more importantly, in plasma may be useful as a biomarker of stroke. Additionally, NM23-H1 significantly reduces metastasis without effects on primary tumor size and was the first discovered metastasis suppressor gene.

  • Allard L, et al. (2005) PARK7 and nucleoside diphosphate kinase A as plasma markers for the early diagnosis of stroke. Clin Chem. 51(11): 2043-51.
  • Steeg PS, et al. (2008) Clinical-translational approaches to the Nm23-H1 metastasis suppressor. Clin Cancer Res. 14(16): 5006-12.
  • Kim HD, et al. (2009) Regulators affecting the metastasis suppressor activity of Nm23-H1. Mol Cell Biochem. 329(1-2): 167-73.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items