Quick Order

Human CPNE1 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CPNE1 cDNA Clone Product Information
Gene_bank_ref_id:BC001142
RefSeq ORF Size:1614bp
cDNA Description:Full length Clone DNA of Homo sapiens copine I with C terminal Flag tag.
Gene Synonym:RP1-309K20.2, COPN1, CPN1, MGC1142, CPNE1
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Copine I, also known as CPN1, is a member of the copine family. Copine I is a calcium-dependent membrane-binding protein which has a wide tissue distribution. Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. Copine I contains two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus, while it does not contain a predicted signal sequence or transmembrane domains. Copine I may function in membrane trafficking.

References
  • Cowland JB, et al. (2003) Tissue expression of copines and isolation of copines I and III from the cytosol of human neutrophils. J Leukoc Biol. 74(3):379-88.
  • Tomsig JL, et al. (2003) Identification of targets for calcium signaling through the copine family of proteins. Characterization of a coiled-coil copine-binding motif. J Biol Chem. 278 (12):10048-54.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Size / Price
    Catalog: HG14283-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"