Quick Order

Text Size:AAA

Human CSH1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSH1cDNA Clone Product Information
Gene_bank_ref_id:NM_001317.3
cDNA Size:654
cDNA Description:ORF Clone of Homo sapiens chorionic somatomammotropin hormone 1 (placental lactogen) DNA.
Gene Synonym:CSH1
Species:Human
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

Chorionic somatomammotropin hormone, also known as Choriomammotropin, Lactogen, Placental lactogen and CSH1, is a secreted protein which belongs to the somatotropin / prolactin family. CSH1 is produced only during pregnancy and is involved in stimulating lactation, fetal growth and metabolism. Does not interact with GHR but only activates PRLR through zinc-induced dimerization. The CSH1 gene is member of the GH gene cluster on 17q, which consists of two growth hormone genes and three CSH genes. Genomic alterations in the GH cluster are well known, causing different phenotypes depending on the size of the deletion and the genes involved. The increased prevalence of hemizygosity of CSH1 in population in comparison to controls indicates a role for CSH1 haploinsufficiency in the etiology of growth retardation. Investigation of CSH1 deletions in further SRS and growth retarded patients will enable us to establish under which circumstances haploinsufficiency of CSH1 is likely to result in clinical changes.

References
  • Prager,S. et al., 2003,Genet Test. 7 (3):259-63.
  • Singleton, DR. et al., 2004, Microbiology. 150 (Pt 2): 285-92.
  • Chen,Y. et al., 2008, Cancer Res. 68 (23):9729-34.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"