Quick Order

Human SULT1B1 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SULT1B1 cDNA Clone Product Information
Gene_bank_ref_id:NM_014465.3
RefSeq ORF Size:891bp
cDNA Description:Full length Clone DNA of Homo sapiens sulfotransferase family, cytosolic, 1B, member 1 with N terminal Flag tag.
Gene Synonym:ST1B2, SULT1B2, MGC13356, SULT1B1
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Sulfotransferase family cytosolic 1B member 1, also known as Sulfotransferase 1B1, Sulfotransferase 1B2, Thyroid hormone sulfotransferase, SULT1B1 and ST1B2, is a cytoplasm protein which belongs to the sulfotransferase 1 family. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. SULT1B1 is highly expressed in the liver, peripheral blood leukocytes, colon (mucosal lining), small intestine (jejunum) and spleen. A lesser expression of SULT1B1 was observed in the lung, placenta and thymus. SULT1B1 catalyzes the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. SULT1B1 sulfates dopamine, small phenols such as 1-naphthol and p-nitrophenol and thyroid hormones, including 3,3'-diiodothyronine, triidothyronine, reverse triiodothyronine and thyroxine.

References
  • Fujita K. et al., 1997, J. Biochem. 122:1052-61.
  • Kester,MH.et al., 2003,Am J Physiol Endocrinol Metab. 285 (3):E592-8.
  • Meinl W, et al., 2001, Biochem Biophys Res Commun. 288 (4): 855-62.
  • Dombrovski L. et al., 2006, Proteins 64: 1091-4.
  • Size / Price
    Catalog: HG11592-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"