Quick Order

Human SNAP25 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SNAP25cDNA Clone Product Information
cDNA Size:660
cDNA Description:ORF Clone of Homo sapiens synaptosomal-associated protein, 25kDa DNA.
Gene Synonym:SNAP-25, RIC-4, RIC4, SEC9, bA416N4.2, dJ1068F16.2
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Synaptosomal-associated protein 25, also known as Super protein, Synaptosomal-associated 25 kDa protein, SNAP25 and SNAP, is a cytoplasm and cell membrane protein which belongs to the SNAP-25 family. SNAP25 / SUP contains 2 t-SNARE coiled-coil homology domains. SNAP25 / SUP is a membrane bound protein anchored to the cytosolic face of membranes via palmitoyl side chains in the middle of the molecule. SNAP25 / SUP protein is a component of the SNARE complex, which is proposed to account for the specificity of membrane fusion and to directly execute fusion by forming a tight complex that brings the synaptic vesicle and plasma membranes together. SNAP25 / SUP is a Q-SNARE protein contributing two α-helices in the formation of the exocytotic fusion complex in neurons where it assembles with syntaxin-1 and synaptobrevin. SNAP25 / SUP is involved in the molecular regulation of neurotransmitter release. It may play an important role in the synaptic function of specific neuronal systems. SNAP25 / SUP associates with proteins involved in vesicle docking and membrane fusion. SNAP25 / SUP regulates plasma membrane recycling through its interaction with CENPF. SNAP25 / SUP inhibits P/Q- and L-type voltage-gated calcium channels located presynaptically and interacts with the synaptotagmin C2B domain in Ca2+-independent fashion. In glutamatergic synapses SNAP25 / SUP decreases the Ca2+ responsiveness, while it is naturally absent in GABAergic synapses.

  • Hodel A ,et al.,1998, Int. J. Biochem. Cell Biol. 30 (10): 1069-73.
  • Sudhof TC, et al.,2002, Nat Rev Neurosci 3 (8): 641-653.
  • Chapman ER et al.,2002, Nat. Rev. Mol. Cell Biol. 3(7): 498-508.
  • Chen X., et al., 2002, Neuron 33:397-409.
  • Huang Q., et al., 2008, FEBS Lett. 582:1431-1436.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human SNAP25 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged