Quick Order

Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PAcDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:2151
cDNA Description:ORF Clone of Influenza A virus polymerase PA DNA.
Gene Synonym:PA
Species:H9N2
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged on other vectors
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40365-ACG$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-OFPSpark tagVG40365-ACR$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-GFPSpark-taggedVG40365-ANG$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-OFPSpark tagVG40365-ANR$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG40365-CF$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG40365-CH$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG40365-CM$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG40365-CY$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40365-G$195
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG40365-NF$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG40365-NH$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG40365-NM$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG40365-NY$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase PA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG40365-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:VG40365-UT
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"