After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PB2cDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:2280
cDNA Description:ORF Clone of Influenza A virus polymerase Pb2 DNA.
Gene Synonym:PB2
Species:H9N2
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged on other vectors
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40364-ACG$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-OFPSpark tagVG40364-ACR$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-GFPSpark-taggedVG40364-ANG$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-OFPSpark tagVG40364-ANR$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG40364-CF$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG40364-CH$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG40364-CM$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG40364-CY$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40364-G$195
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG40364-NF$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG40364-NH$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG40364-NM$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG40364-NY$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG40364-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:VG40364-UT
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"