After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H9N2 PB1 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:2274bp
cDNA Description:Full length Clone DNA of Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1.
Gene Synonym:PB1
Species:H9N2
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AGE15506.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 ORF mammalian expression plasmid (Codon Optimized) on other vectors
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tagVG40363-ACG$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40363-ACR$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 ORF mammalian expression plasmid, N-GFPSpark tagVG40363-ANG$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 (Codon Optimized) ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40363-ANR$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 ORF mammalian expression plasmid (Codon Optimized), C-FLAG-taggedVG40363-CF$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40363-CH$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40363-CM$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40363-CY$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 ORF mammalian expression plasmid (Codon Optimized)VG40363-G$195
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40363-NF$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40363-NH$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 (Codon Optimized) ORF mammalian expression plasmid, N-Myc tagVG40363-NM$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40363-NY$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb1 ORF mammalian expression plasmid (Codon Optimized)VG40363-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40363-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"