Quick Order

Text Size:AAA

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
WNV-NS5cDNA Clone Product Information
cDNA Size:2715
cDNA Description:ORF Clone of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 DNA.
Gene Synonym:WNV-NS5
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40348-ACG$425
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagVG40348-ACR$425
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedVG40348-ANG$425
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagVG40348-ANR$425
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40348-CF$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40348-CH$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40348-CM$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40348-CY$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone)VG40348-G$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40348-NF$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40348-NH$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40348-NM$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40348-NY$395
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS5 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40348-UT$395
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $395.00  (Save $0.00)
Price:$395.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items