After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
WNV WNV-NS1 cDNA Clone Product Information
Gene_bank_ref_id:DQ211652.1
RefSeq ORF Size:1056bp
cDNA Description:Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1.
Gene Synonym:WNV-NS1
Species:WNV
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence DQ211652.1 (2470..3525), corresponding to amino acid sequence YP_001527881.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 natural ORF mammalian expression plasmid on other vectors
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, C-GFPSpark tagVG40346-ACG$325
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40346-ACR$325
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, N-GFPSpark tagVG40346-ANG$325
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40346-ANR$325
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40346-CF$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, C-His tagVG40346-CH$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, C-Myc tagVG40346-CM$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, C-HA tagVG40346-CY$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid (Codon Optimized)VG40346-G$95
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, N-Flag tagVG40346-NF$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, N-His tagVG40346-NH$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, N-Myc tagVG40346-NM$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, N-HA tagVG40346-NY$295
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 natural ORF mammalian expression plasmidVG40346-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40346-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"