Quick Order

Text Size:AAA

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
WNV-prM and EcDNA Clone Product Information
cDNA Size:2064
cDNA Description:ORF Clone of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E DNA.
Gene Synonym:WNV-prM and E
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40345-ACG$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagVG40345-ACR$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedVG40345-ANG$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagVG40345-ANR$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40345-CF$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40345-CH$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40345-CM$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40345-CY$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone)VG40345-G$195
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40345-NF$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40345-NH$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40345-NM$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40345-NY$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40345-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability5 business days
  • West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) prM and E Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items