Quick Order

Text Size:AAA

Human NLK ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NLK cDNA Clone Product Information
Gene_bank_ref_id:NM_002946.3
RefSeq ORF Size:1584bp
cDNA Description:Full length Clone DNA of Homo sapiens nemo-like kinase with N terminal Flag tag.
Gene Synonym:FLJ21033, DKFZp761G1211, NLK
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Nemo-like kinase contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family and MAP kinase subfamily. It also contains a TQE activation loop motif in which autophosphorylation of the threonine residue (Thr-298) is sufficient for kinase activation. As a serine/threonine-protein kinase, nemo-like kinase regulates a number of transcription factors with key roles in cell fate determination. It is a positive effector of the non-canonical Wnt signaling pathway, acting downstream of WNT5A, MAP3K7/TAK1 and HIPK2. Activation of this pathway causes binding to and phosphorylation of the histone methyltransferase SETDB1. The NLK-SETDB1 complex subsequently interacts with PPARG, leading to methylation of PPARG target promoters at histone H3K9 and transcriptional silencing. The resulting loss of PPARG target gene transcription inhibits adipogenesis and promotes osteoblastogenesis in mesenchymal stem cells (MSCs). Nemo-like kinase also is a negative regulator of the canonical Wnt/beta-catenin signaling pathway.

References
  • Smit L, et al. (2004) Wnt activates the Tak1/Nemo-like kinase pathway. J Biol Chem. 279(17): 17232-40.
  • Yasuda J, et al. (2004) Nemo-like kinase suppresses a wide range of transcription factors, including nuclear factor-kappaB. Cancer Sci. 95(1):52-7.
  • Yasuda J, et al. (2003) Nemo-like kinase induces apoptosis in DLD-1 human colon cancer cells. Biochem Biophys Res Commun. 308(2):227-335.
  • Ishitani T, et al. (2003) Regulation of lymphoid enhancer factor 1/T-cell factor by mitogen-activated protein kinase-related Nemo-like kinase-dependent phosphorylation in Wnt/beta-catenin signaling. Mol Cell Biol. 23(4):1379-89.
  • Size / Price
    Catalog: HG11573-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"