Quick Order

Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SFTSV SFTSV-M cDNA Clone Product Information
NCBI RefSeq:KC505124.1
RefSeq ORF Size:3222bp
cDNA Description:Full length Clone DNA of Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M.
Gene Synonym:SFTSV-M
Species:SFTSV
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M natural ORF mammalian expression plasmid on other vectors
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M ORF mammalian expression plasmid, C-GFPSpark tagVG40341-ACG$425
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40341-ACR$425
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M ORF mammalian expression plasmid, N-GFPSpark tagVG40341-ANG$425
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40341-ANR$425
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40341-CF$395
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M ORF mammalian expression plasmid, C-His tagVG40341-CH$395
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M ORF mammalian expression plasmid, C-Myc tagVG40341-CM$395
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M ORF mammalian expression plasmid, C-HA tagVG40341-CY$395
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M ORF mammalian expression plasmid (Codon Optimized)VG40341-G$295
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M ORF mammalian expression plasmid, N-Flag tagVG40341-NF$395
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M ORF mammalian expression plasmid, N-His tagVG40341-NH$395
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M ORF mammalian expression plasmid, N-Myc tagVG40341-NM$395
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M ORF mammalian expression plasmid, N-HA tagVG40341-NY$395
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) M natural ORF mammalian expression plasmidVG40341-UT$395
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40341-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"