After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rift Valley fever virus (RVFV) (strain MP12) NSs natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RVFV RVFV-NSs cDNA Clone Product Information
Gene_bank_ref_id:DQ380154.1
RefSeq ORF Size:798bp
cDNA Description:Full length Clone DNA of Rift Valley fever virus (RVFV) (strain MP12) NSs.
Gene Synonym:RVFV-NSs
Species:RVFV
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Rift Valley fever virus (RVFV) (strain MP12) NSs natural ORF mammalian expression plasmid on other vectors
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, C-GFPSpark tagVG40339-ACG$325
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40339-ACR$325
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-GFPSpark tagVG40339-ANG$325
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40339-ANR$325
Rift Valley fever virus (RVFV) (strain MP12) NSs Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40339-CF$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, C-His tagVG40339-CH$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, C-Myc tagVG40339-CM$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, C-HA tagVG40339-CY$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid (Codon Optimized)VG40339-G$95
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-Flag tagVG40339-NF$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-His tagVG40339-NH$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-Myc tagVG40339-NM$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-HA tagVG40339-NY$295
Rift Valley fever virus (RVFV) (strain MP12) NSs natural ORF mammalian expression plasmidVG40339-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40339-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"