Quick Order

Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
 PRRSV-N cDNA Clone Product Information
Gene_bank_ref_id:U87392.3
RefSeq ORF Size:372bp
cDNA Description:Full length Clone DNA of Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N.
Gene Synonym:PRRSV-N
Species:PRRSV
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N natural ORF mammalian expression plasmid on other vectors
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-GFPSpark tagVG40337-ACG$325
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40337-ACR$325
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-GFPSpark tagVG40337-ANG$325
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40337-ANR$325
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40337-CF$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-His tagVG40337-CH$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-Myc tagVG40337-CM$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, C-HA tagVG40337-CY$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid (Codon Optimized)VG40337-G$95
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-Flag tagVG40337-NF$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-His tagVG40337-NH$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-Myc tagVG40337-NM$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N ORF mammalian expression plasmid, N-HA tagVG40337-NY$295
Porcine reproductive and respiratory syndrome virus (PRRSV) (type 2, strain ATCC VR2332 (NA)) N natural ORF mammalian expression plasmidVG40337-UT$295
 Learn more about expression Vectors
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"