Quick Order

Text Size:AAA

Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HeV-NcDNA Clone Product Information
cDNA Size:1599
cDNA Description:ORF Clone of Hendra virus (HeV) (isolate Hendra virus/Australia/horse/1994/Hendra) N DNA.
Gene Synonym:HeV-N
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40332-ACG$345
Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagVG40332-ACR$345
Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedVG40332-ANG$345
Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagVG40332-ANR$345
Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40332-CF$315
Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40332-CH$315
Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40332-CM$315
Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40332-CY$315
Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone)VG40332-G$195
Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40332-NF$315
Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40332-NH$315
Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40332-NM$315
Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40332-NY$315
Hendra virus (HeV) N Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40332-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name