Quick Order

Nipah virus (NiV) (strain Malaysian (NiV-M)) M natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NiV NiV-M cDNA Clone Product Information
NCBI RefSeq:AY029767.1
RefSeq ORF Size:1059bp
cDNA Description:Full length Clone DNA of Nipah virus (NiV) (strain Malaysian (NiV-M)) M.
Gene Synonym:NiV-M
Species:NiV
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Nipah virus (NiV) (strain Malaysian (NiV-M)) M natural ORF mammalian expression plasmid on other vectors
Nipah virus (NiV) (strain Malaysian (NiV-M)) M ORF mammalian expression plasmid, C-GFPSpark tagVG40330-ACG$325
Nipah virus (NiV) (strain Malaysian (NiV-M)) M ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40330-ACR$325
Nipah virus (NiV) (strain Malaysian (NiV-M)) M ORF mammalian expression plasmid, N-GFPSpark tagVG40330-ANG$325
Nipah virus (NiV) (strain Malaysian (NiV-M)) M ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40330-ANR$325
Nipah virus (NiV) (strain Malaysian (NiV-M)) M Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40330-CF$295
Nipah virus (NiV) (strain Malaysian (NiV-M)) M ORF mammalian expression plasmid, C-His tagVG40330-CH$295
Nipah virus (NiV) (strain Malaysian (NiV-M)) M ORF mammalian expression plasmid, C-Myc tagVG40330-CM$295
Nipah virus (NiV) (strain Malaysian (NiV-M)) M ORF mammalian expression plasmid, C-HA tagVG40330-CY$295
Nipah virus (NiV) (strain Malaysian (NiV-M)) M ORF mammalian expression plasmid (Codon Optimized)VG40330-G$95
Nipah virus (NiV) (strain Malaysian (NiV-M)) M ORF mammalian expression plasmid, N-Flag tagVG40330-NF$295
Nipah virus (NiV) (strain Malaysian (NiV-M)) M ORF mammalian expression plasmid, N-His tagVG40330-NH$295
Nipah virus (NiV) (strain Malaysian (NiV-M)) M ORF mammalian expression plasmid, N-Myc tagVG40330-NM$295
Nipah virus (NiV) (strain Malaysian (NiV-M)) M ORF mammalian expression plasmid, N-HA tagVG40330-NY$295
Nipah virus (NiV) (strain Malaysian (NiV-M)) M natural ORF mammalian expression plasmidVG40330-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40330-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"