Quick Order

Text Size:AAA

Nipah virus (NiV) (strain Malaysian (NiV-M)) N natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NiV NiV-N cDNA Clone Product Information
Gene_bank_ref_id:AY029767.1
RefSeq ORF Size:1599bp
cDNA Description:Full length Clone DNA of Nipah virus (NiV) (strain Malaysian (NiV-M)) N.
Gene Synonym:NiV-N
Species:NiV
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Nipah virus (NiV) (strain Malaysian (NiV-M)) N natural ORF mammalian expression plasmid on other vectors
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-GFPSpark tagVG40329-ACG$345
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40329-ACR$345
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-GFPSpark tagVG40329-ANG$345
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40329-ANR$345
Nipah virus (NiV) (strain Malaysian (NiV-M)) N Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40329-CF$315
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-His tagVG40329-CH$315
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-Myc tagVG40329-CM$315
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, C-HA tagVG40329-CY$315
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid (Codon Optimized)VG40329-G$195
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-Flag tagVG40329-NF$315
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-His tagVG40329-NH$315
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-Myc tagVG40329-NM$315
Nipah virus (NiV) (strain Malaysian (NiV-M)) N ORF mammalian expression plasmid, N-HA tagVG40329-NY$315
Nipah virus (NiV) (strain Malaysian (NiV-M)) N natural ORF mammalian expression plasmidVG40329-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40329-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"