Quick Order

Text Size:AAA

Plasmodium falciparum (strain 3D7) HPRT natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
P. falciparum HPRT cDNA Clone Product Information
Gene_bank_ref_id:XM_001347370.1
RefSeq ORF Size:696bp
cDNA Description:Full length Clone DNA of Plasmodium falciparum (strain 3D7) hypoxanthine phosphoribosyltransferase.
Gene Synonym:HPRT
Species:P. falciparum
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Plasmodium falciparum (strain 3D7) HPRT natural ORF mammalian expression plasmid on other vectors
Product nameProduct name
Size / Price
Catalog: VG40301-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"