Quick Order

Text Size:AAA

Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
P. falciparum AMA1 cDNA Clone Product Information
Gene_bank_ref_id:XM_001347979.1
RefSeq ORF Size:1635bp
cDNA Description:Full length Clone DNA of Plasmodium falciparum (strain 3D7) apical membrane antigen 1 (extracellular domain, ECD).
Gene Synonym:AMA1
Species:P. falciparum
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) natural ORF mammalian expression plasmid on other vectors
Plasmodium falciparum (strain 3D7) AMA1 (Codon Optimized) ORF mammalian expression plasmid, C-GFPSpark tagVG40296-ACG$345
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40296-ACR$345
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, C-FLAG-taggedVG40296-CF$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, C-His-taggedVG40296-CH$315
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) ORF mammalian expression plasmid, C-Myc tagVG40296-CM$315
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) ORF mammalian expression plasmid, C-HA tagVG40296-CY$315
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) natural ORF mammalian expression plasmidVG40296-G$195
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) ORF mammalian expression plasmid, N-Flag tagVG40296-NF$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, N-His-taggedVG40296-NH$315
Plasmodium falciparum (strain 3D7) AMA1 Gene cDNA Clone / ORF Clone (extracellular domain, ECD), expression ready, N-Myc-taggedVG40296-NM$315
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) ORF mammalian expression plasmid, N-HA tagVG40296-NY$315
Plasmodium falciparum (strain 3D7) AMA1 (extracellular domain, ECD) natural ORF mammalian expression plasmidVG40296-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40296-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"