After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ICOSLG ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ICOSLG cDNA Clone Product Information
Gene_bank_ref_id:NM_015259.4
RefSeq ORF Size:908bp
cDNA Description:Full length Clone DNA of Homo sapiens inducible T-cell co-stimulator ligand with N terminal Flag tag.
Gene Synonym:B7H2, GL50, B7-H2, B7RP1, CD275, ICOSL, LICOS, B7RP-1, ICOS-L, KIAA0653, ICOSLG
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-ICOSLG
Restriction Site:KpnI + XbaI (6kb + 0.94kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ICOSLG Gene Plasmid Map
Human ICOSLG natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Inducible co-stimulator ligand (ICOSL), also known as B7-H2, is a member of the B7 family of co-stimulatory molecules related to B7-1 and B7-2. It is a transmembrane glycoprotein with extracellular IgV and IgC domains, and binds to ICOS on activated T cells, thus delivers a positive costimulatory signal for optimal T cell function. The structural features of ICOSL are crucial for its costimulatory function. Present study shows that ICOSL displays a marked oligomerization potential, resembling more like B7-1 than B7-2. B7-H2-dependent signaling may play an active role in a proliferative response rather than in cytokine and chemokine production. The CD28/B7 and ICOS/B7-H2 pathways are both critical for costimulating T cell immune responses. Deficiency in either pathway results in defective T cell activation, cytokine production and germinal center formation.

References
  • Flesch IE. (2002) Inducible costimulator-ligand (ICOS-L). J Biol Regul Homeost Agents. 16(3): 217-9.
  • Kajiwara K, et al. (2009) Expression and function of the inducible costimulator ligand B7-H2 in human airway smooth muscle cells. Allergol Int. 58(4): 573-83.
  • Wong SC, et al. (2009) Functional hierarchy and relative contribution of the CD28/B7 and ICOS/B7-H2 costimulatory pathways to T cell-mediated delayed-type hypersensitivity. Cell Immunol. 256(1-2): 64-71.
  • Size / Price
    Catalog: HG11559-NF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"