Quick Order

Human NCR2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NCR2cDNA Clone Product Information
cDNA Size:831
cDNA Description:ORF Clone of Homo sapiens natural cytotoxicity triggering receptor 2 DNA.
Gene Synonym:LY95, CD336, NKP44, NK-p44, dJ149M18.1, NCR2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Natural cytotoxicity triggering receptor 2 (NCR2), also known as Natural killer cell p44-related protein (NKp44), or CD336, is a member of the natural cytotoxicity receptor (NCR) family, which composed of one Ig-like extracellular domain, a transmembrane segment, and a cytoplasmic domain. It is a novel transmembrane glycoprotein belonging to the Immunoglobulin superfamily characterized by a single extracellular V-type domain. The cytoplasmic domain of NKp44 also contains a sequence that matches the immunoreceptor tyrosine-based inhibitory motif (ITIM) consensus. This Cytotoxicity-activating receptor that may contribute to the increased efficiency of activated natural killer (NK) cells to mediate tumor cell lysis. NKp44 is selectively expressed by IL-2-activated NK cells and may contribute to the increased efficiency of activated NK cells to mediate tumor cell lysis. Tumor cell recognition of the mutated NKp44 proteins was significantly reduced and correlated with their lower recognition of heparin.

  • Vitale M, et al. (1998) NKp44, a novel triggering surface molecule specifically expressed by activated natural killer cells, is involved in non-major histocompatibility complex-restricted tumor cell lysis. J Exp Med. 187(12): 2065-72.
  • Cantoni C, et al. (1999) NKp44, a triggering receptor involved in tumor cell lysis by activated human natural killer cells, is a novel member of the immunoglobulin superfamily. J Exp Med. 189: 787-96.
  • Cantoni C, et al. (2003) The three-dimensional structure of the human NK cell receptor NKp44, a triggering partner in natural cytotoxicity. Structure. 11(6): 725-34.
  • Campbell KS, et al. (2004) NKp44 triggers NK cell activation through DAP12 association that is not influenced by a putative cytoplasmic inhibitory sequence. J Immunol. 172(2): 899-906.
  • Hershkovitz O, et al. (2007) Characterization of the recognition of tumor cells by the natural cytotoxicity receptor, NKp44. Biochemistry. 46(25): 7426-36.