Quick Order

Human TAOK3 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TAOK3 cDNA Clone Product Information
Gene_bank_ref_id:NM_016281.3
RefSeq ORF Size:2697bp
cDNA Description:Full length Clone DNA of Homo sapiens TAO kinase 3 with N terminal Flag tag.
Gene Synonym:DPK, JIK, MAP3K18, FLJ31808, DKFZp666H245, TAOK3
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Serine/threonine-protein kinase TAO3, also known as cutaneous T-cell lymphoma-associated antigen HD-CL-09, CTCL-associated antigen HD-CL-09, Dendritic cell-derived protein kinase, JNK / SAPK-inhibitory kinase, Jun kinase-inhibitory kinase, Kinase from chicken homolog A, Thousand and one amino acid protein 3, JIK, TAOK3 and MAP3K18, is cytoplasm and peripheral membrane protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and STE20 subfamily. Protein kinases are pivotal regulators of cell signaling that modulate each other's functions and activities through site-specific phosphorylation events. TAOK3 / JIK contains one protein kinase domain. TAOK3 / JIK is ubiquitously expressed at a low level, and highly expressed in peripheral blood leukocytes (PBLs), thymus, spleen, kidney, skeletal muscle, heart and liver. TAOK3 / JIK inhibits the basal activity of Jun kinase. It is negatively regulated by epidermal growth factor (EGF). When overexpressed, TAOK3 / JIK may activate ERK1 / ERK2 and JNK / SAPK.

References
  • Tassi E., et al., 1999, J. Biol. Chem. 274:33287-95.
  • Yoneda T., et al., 2001, J. Biol. Chem. 276:13935-40.
  • Yustein J.T., et al.,2003, Oncogene 22:6129-41.
  • Daub H., et al., 2008, Mol. Cell 31:438-48.
  • Size / Price
    Catalog: HG11547-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"