Quick Order

Hepatitis C virus (HCV-1b) Core natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HCV HCV-Core cDNA Clone Product Information
Gene_bank_ref_id:AF054250.1
RefSeq ORF Size:576bp
cDNA Description:Full length Clone DNA of Hepatitis C virus (HCV) (serotype 1b, isolate HC-J4) Core.
Gene Synonym:HCV-Core
Species:HCV
Vector:pCMV3-untagged
Plasmid:pCMV3-HCV1b-AF054250-Core
Restriction Site:HindIII + XbaI (6.1kb + 0.58kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Product nameProduct name
Size / Price
Catalog: VG40287-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"