Quick Order

Hepatitis C virus (HCV-1a) P7 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HCV HCV-P7 cDNA Clone Product Information
Gene_bank_ref_id:NC_004102.1
RefSeq ORF Size:189bp
cDNA Description:Full length Clone DNA of Hepatitis C virus (HCV) (serotype 1a, isolate H77) P7.
Gene Synonym:HCV-P7
Species:HCV
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence NC_004102.1 (2580..2768), corresponding to amino acid sequence NP_751922.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Product nameProduct name
Size / Price
Catalog: VG40281-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"