After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PAK3 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PAK3 cDNA Clone Product Information
Gene_bank_ref_id:NM_001128166.1
RefSeq ORF Size:1635bp
cDNA Description:Full length Clone DNA of Homo sapiens p21 protein (Cdc42/Rac)-activated kinase 3 with N terminal Flag tag.
Gene Synonym:bPAK, MRX30, MRX47, OPHN3, hPAK3, CDKN1A, PAK3beta, PAK3
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

PAK3 is a member of PAK proteins, a family of serine/threonine p21-activating kinases, serve as effectors of small Rho GTPases Cdc42 and RAC and have been implicated in a wide range of biological activities. There are six mammalian PAKs which can be divided into two groups: group I PAKs (PAK1-3) and group II PAKs (PAK4-6). Although the two PAK groups are architecturally similar there are differences in their mode of regulation suggesting their cellular functions are likely to be different. Group I p21-activated kinases (PAK1/2/3) is demonstrated as ERK3/ERK4 activation loop kinases. It has been shown that group I PAKs phosphorylate ERK3 and ERK4 on Ser-189 and Ser-186, respectively, both in vitro and in vivo, and that expression of activated Rac1 augments this response. Besides regulation enzymatic activation of ERK3/ERK4, PAKs can also play roles in downstream activation of MAP kinase-activated protein kinase 5 (MK5) in vivo. Thus, the  group I PAKs act as upstream activators of ERK3 and ERK4 and unravel a novel PAK-ERK3/ERK4-MK5 signaling pathway. In clinical, PAK has been proposed as a potential therapeutic target in schwannomas.

References
  • Whale A, et al. (2011) Signalling to cancer cell invasion through PAK family kinases. Front Biosci. 16: 849-64.
  • Deleris P, et al. (2011) Activation loop phosphorylation of ERK3/ERK4 by group I p21-activated kinases (PAKs) defines a novel PAK-ERK3/4-MAPK-activated protein kinase 5 signaling pathway. J Biol Chem. 286 (8): 6470-8.
  • Canet B, et al. (2011) Ovarian clear cell carcinomas: RHO GTPases may contribute to explain their singular biologic behavior. Hum Pathol. 42 (6): 833-9.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"