After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DENV-NS4AcDNA Clone Product Information
Gene_bank_ref_id:AF038403.1
cDNA Size:381
cDNA Description:ORF Clone of DENV-2 (strain New Guinea C) NS4A DNA.
Gene Synonym:DENV-NS4A
Species:DENV
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40265-ACG$325
Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagVG40265-ACR$325
Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedVG40265-ANG$325
Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagVG40265-ANR$325
Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40265-CF$295
Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40265-CH$295
Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40265-CM$295
Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40265-CY$295
Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone)VG40265-G$95
Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40265-NF$295
Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40265-NH$295
Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40265-NM$295
Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40265-NY$295
Dengue virus DENV-2 (strain New Guinea C) NS4A Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40265-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:VG40265-UT
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"