Quick Order

HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HIV HIV-gag cDNA Clone Product Information
Gene_bank_ref_id:AB731740.1
RefSeq ORF Size:1566bp
cDNA Description:Full length Clone DNA of HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag.
Gene Synonym:HIV-gag
Species:HIV
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag natural ORF mammalian expression plasmid on other vectors
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-GFPSpark tagVG40260-ACG$345
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40260-ACR$345
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-GFPSpark tagVG40260-ANG$345
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40260-ANR$345
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-Flag tagVG40260-CF$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-His tagVG40260-CH$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-Myc tagVG40260-CM$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-HA tagVG40260-CY$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid (Codon Optimized)VG40260-G$195
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-Flag tagVG40260-NF$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-His tagVG40260-NH$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-Myc tagVG40260-NM$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-HA tagVG40260-NY$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag natural ORF mammalian expression plasmidVG40260-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40260-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"