Quick Order

HIV-1 (group M, subtype C, strain 92BR025.8) gag natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HIV HIV-gag cDNA Clone Product Information
Gene_bank_ref_id:U52953.1
RefSeq ORF Size:1491bp
cDNA Description:Full length Clone DNA of HIV-1 (group M, subtype C, strain 92BR025.8) gag.
Gene Synonym:HIV-gag
Species:HIV
Vector:pCMV3-untagged
Plasmid:pCMV3-HIV1-U52953-GAG
Restriction Site:KpnI + XbaI (6.1kb + 1.49kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
HIV-1 (group M, subtype C, strain 92BR025.8) gag natural ORF mammalian expression plasmid on other vectors
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-GFPSpark tagVG40250-ACG$325
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40250-ACR$325
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-GFPSpark tagVG40250-ANG$325
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40250-ANR$325
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-Flag tagVG40250-CF$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-His tagVG40250-CH$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-Myc tagVG40250-CM$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-HA tagVG40250-CY$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid (Codon Optimized)VG40250-G$95
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-Flag tagVG40250-NF$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-His tagVG40250-NH$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-Myc tagVG40250-NM$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-HA tagVG40250-NY$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag natural ORF mammalian expression plasmidVG40250-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40250-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"