Quick Order

HIV-1 (group M, subtype B, strain HXB2) env natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HIV HIV-env cDNA Clone Product Information
Gene_bank_ref_id:K03455
RefSeq ORF Size:2571bp
cDNA Description:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) env.
Gene Synonym:HIV-env
Species:HIV
Vector:pCMV3-untagged
Plasmid:pCMV3-HIV1-K03455-ENV
Restriction Site:KpnI(two restriction sites) + XbaI (6.1kb + 2.45kb + 0.13kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
HIV HIV-env Gene Plasmid Map
HIV-1 (group M, subtype B, strain HXB2) env natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: VG40248-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"