Quick Order

Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NAcDNA Clone Product Information
cDNA Size:1401
cDNA Description:ORF Clone of Influenza A H10N8 (A/duck/Guangdong/E1/2012) NA DNA.
Gene Synonym:NA
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40203-ACG$325
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone / ORF Clone (full-length ORF Clone), expression ready, C-OFPSpark tagVG40203-ACR$325
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedVG40203-ANG$325
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone / ORF Clone (full-length ORF Clone), expression ready, N-OFPSpark tagVG40203-ANR$325
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40203-CF$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40203-CH$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40203-CM$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40203-CY$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone / ORF Clone (full-length ORF Clone)VG40203-G$95
Influenza B (B/Brisbane/60/2008) Neuraminidase / NA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG40203-G-N$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40203-NF$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40203-NH$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40203-NM$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40203-NY$295
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40203-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell.

Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins.

Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell.

Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection.

Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days
  • Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items