Quick Order

Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H9N2 HA cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1683bp
cDNA Description:Full length Clone DNA of Influenza A H9N2 (A/Hong Kong/3239/2008) Hemagglutinin.
Gene Synonym:Hemagglutinin, HA
Species:H9N2
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ADC41863.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) on other vectors
Influenza A H9N2 (A/Hong Kong/3239/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40178-ACG$345
Influenza A H9N2 (A/Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40178-ACR$345
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40178-CF$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40178-CH$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40178-CM$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40178-CY$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40178-NF$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40178-NH$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40178-NM$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40178-NY$315
Influenza A H9N2 (Hong Kong/3239/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40178-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40178-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"