Quick Order

MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CoV-orf4bcDNA Clone Product Information
Gene_bank_ref_id:JX869059.2
cDNA Size:741
cDNA Description:ORF Clone of MERS-CoV (HCoV-EMC/2012) orf4b DNA.
Gene Synonym:CoV-orf4b
Species:MERS-CoV
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40084-ACG$325
MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagVG40084-ACR$325
MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedVG40084-ANG$325
MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagVG40084-ANR$325
MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40084-CF$295
MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40084-CH$295
MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40084-CM$295
MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40084-CY$295
MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone)VG40084-G$95
MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40084-NF$295
MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40084-NH$295
MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40084-NM$295
MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40084-NY$295
MERS-CoV (HCoV-EMC/2012) orf4b Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40084-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:VG40084-UT
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"