After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HDAC3cDNA Clone Product Information
cDNA Size:1287
cDNA Description:ORF Clone of Homo sapiens histone deacetylase 3 DNA.
Gene Synonym:HD3, RPD3, RPD3-2, HDAC3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11511-ACG$325
Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11511-ACR$325
Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11511-ANG$325
Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11511-ANR$325
Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11511-CF$295
Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11511-CH$295
Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11511-CM$295
Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11511-CY$295
Human HDAC3 Gene cDNA Clone (full-length ORF Clone)HG11511-M$95
Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11511-M-F$295
Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11511-M-N$295
Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11511-NF$295
Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11511-NH$295
Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11511-NM$295
Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11511-NY$295
Human HDAC3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11511-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Histone Deacetylases (HDACs) are a group of enzymes closely related to sirtuins. They catalyze the removal of acetyl groups from lysine residues in histones and non-histone proteins, resulting in transcriptional repression. In general, they do not act autonomously but as components of large multiprotein complexes, such as pRb-E2F and mSin3A, that mediate important transcription regulatory pathways. There are three classes of HDACs; classes 1, 2 and 4, which are closely related Zn2+-dependent enzymes. HDACs are ubiquitously expressed and they can exist in the nucleus or cytosol. Their subcellular localization is effected by protein-protein interactions (for example HDAC-14.3.3 complexes are retained in the cytosol) and by the class to which they belong (class 1 HDACs are predominantly nuclear whilst class 2 HDACs shuttle between the nucleus and cytosol). HDACs have a role in cell growth arrest, differentiation and death and this has led to substantial interest in HDAC inhibitors as possible antineoplastic agents. Histone Deacetylases (HDACs) is Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2, H3 and H4). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. Probably participates in the regulation of transcription through its binding to the zinc-finger transcription factor YY1; increases YY1 repression activity. Required to repress transcription of the POU1F1 transcription factor. Acts as a molecular chaperone for shuttling phosphorylated NR2C1 to PML bodies for sumoylation.

  • Emiliani S, et al. (1998) Characterization of a human RPD3 ortholog, HDAC3. Proc Natl Acad Sci. 95 (6): 2795-800.
  • Dangond F, et al. (1998) Differential display cloning of a novel human histone deacetylase (HDAC3) cDNA from PHA-activated immune cells. Biochem Biophys Res Commun. 242 (3): 648-52.
  • Nicolas E, et al. (2001) The histone deacetylase HDAC3 targets RbAp48 to the retinoblastoma protein. Nucleic Acids Res. 29 (15): 3131-6.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items