Quick Order

Text Size:AAA

Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H4N8 HA cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1695bp
cDNA Description:Full length Clone DNA of Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin.
Gene Synonym:Hemagglutinin, HA
Species:H4N8
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P19695.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) on other vectors
Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40025-ACG$345
Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40025-ACR$345
Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40025-C$395
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40025-CF$315
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40025-CH$315
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40025-CM$315
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40025-CY$315
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40025-NF$315
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40025-NH$315
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40025-NM$315
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40025-NY$315
Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40025-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40025-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"