Quick Order

Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged, expression ready

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HAcDNA Clone Product Information
cDNA Size:1731
cDNA Description:ORF Clone of Influenza A H5N1 (A/Duck/Hong Kong/p46/97) HA DNA.
Gene Synonym:HA1, Hemagglutinin
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged, expression ready on other vectors
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-tagged, expression readyVG40001-ACG$345
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, expression ready, C-OFPSpark tagVG40001-ACR$345
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression readyVG40001-C$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged, expression readyVG40001-CF$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged, expression readyVG40001-CH$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged, expression readyVG40001-CM$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged, expression readyVG40001-CY$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged, expression readyVG40001-NF$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged, expression readyVG40001-NH$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged, expression readyVG40001-NM$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged, expression readyVG40001-NY$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged, expression readyVG40001-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name